Environmental Stress Induces Trinucleotide Repeat Mutagenesis in Human Cells by Alt-Nonhomologous End Joining Repair.
نویسندگان
چکیده
Multiple pathways modulate the dynamic mutability of trinucleotide repeats (TNRs), which are implicated in neurodegenerative disease and evolution. Recently, we reported that environmental stresses induce TNR mutagenesis via stress responses and rereplication, with more than 50% of mutants carrying deletions or insertions-molecular signatures of DNA double-strand break repair. We now show that knockdown of alt-nonhomologous end joining (alt-NHEJ) components-XRCC1, LIG3, and PARP1-suppresses stress-induced TNR mutagenesis, in contrast to the components of homologous recombination and NHEJ, which have no effect. Thus, alt-NHEJ, which contributes to genetic mutability in cancer cells, also plays a novel role in environmental stress-induced TNR mutagenesis.
منابع مشابه
Allelic spectrum of the RNA guided CRISPR/Cas9 DNA repair events at PAM associated trinucleotide repeat (NGG)n in Caenorhabditis elegans
associated trinucleotide repeat (NGG)n in Caenorhabditis elegans. Abstract: This work describes the experience with implementation of Streptococcus pyogenes Cas9 nuclease, expressed in C. elegans germline. The described work utilizes guide RNA-unc-22-1000 (GGAGAAGGAGGCGGTGCTGG) designed to target the polyglycine encoding stretch within the unc-22gene embedding the impure trinucleotide (NGG)n PA...
متن کاملChapter 3 : Ancl Regulates the Environmental Stress Response and May Mediate a Response to Damage - Induced Mecl Signaling
....................................................................................... 4 Chapter 1: Introduction........................................................ 5 Ancl background ......................................................................... 5 Mixed-linkage leukemia and the human YEATS family...........................9 Ancl-containing complexes TFIID, TFIIF and Mediator com...
متن کامل53BP1 promotes microhomology-mediated end-joining in G1-phase cells
Alternative non-homologous end joining (alt-NHEJ) was originally identified as a backup repair mechanism in the absence of classical NHEJ (c-NHEJ) factors but recent studies have demonstrated that alt-NHEJ is active even when c-NHEJ as well as homologous recombination is available. The functions of 53BP1 in NHEJ processes are not well understood. Here, we report that 53BP1 promotes DNA double-s...
متن کاملMicrohomology-mediated end joining induces hypermutagenesis at breakpoint junctions
Microhomology (MH) flanking a DNA double-strand break (DSB) drives chromosomal rearrangements but its role in mutagenesis has not yet been analyzed. Here we determined the mutation frequency of a URA3 reporter gene placed at multiple locations distal to a DSB, which is flanked by different sizes (15-, 18-, or 203-bp) of direct repeat sequences for efficient repair in budding yeast. Induction of...
متن کاملAlternative-NHEJ Is a Mechanistically Distinct Pathway of Mammalian Chromosome Break Repair
Characterizing the functional overlap and mutagenic potential of different pathways of chromosomal double-strand break (DSB) repair is important to understand how mutations arise during cancer development and treatment. To this end, we have compared the role of individual factors in three different pathways of mammalian DSB repair: alternative-nonhomologous end joining (alt-NHEJ), single-strand...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید
ثبت ناماگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید
ورودعنوان ژورنال:
- Proceedings of the National Academy of Sciences of the United States of America
دوره 112 12 شماره
صفحات -
تاریخ انتشار 2015